View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2722_low_37 (Length: 276)

Name: NF2722_low_37
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2722_low_37
NF2722_low_37
[»] chr3 (2 HSPs)
chr3 (145-261)||(49119675-49119791)
chr3 (19-50)||(49119795-49119826)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 145 - 261
Target Start/End: Complemental strand, 49119791 - 49119675
Alignment:
145 atttaattaagtagaaagctaaaaggaattcaaggtagaatttaaaccaatatatgcatttcaacgatcaaaacgaatgaaatattgatatgacaatcac 244  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||    
49119791 atttaattaagtagaaagctaaatggaattcaaggtagaatttaaaccaatatatgcatttcaaccatcaaaaggaatgaaatattgatacgacaatcac 49119692  T
245 aatcccgattttttcaa 261  Q
    |||||||||||||||||    
49119691 aatcccgattttttcaa 49119675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 50
Target Start/End: Complemental strand, 49119826 - 49119795
Alignment:
19 gataaatgtaaagcaaacactaataaaacggt 50  Q
    ||||||||||||||||||||||||||||||||    
49119826 gataaatgtaaagcaaacactaataaaacggt 49119795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University