View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_45 (Length: 232)
Name: NF2722_low_45
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 25640734 - 25640934
Alignment:
| Q |
16 |
caaaggaagctcagatcagattgggataaaatataaaaagtattatggcgaccacttgaccacatgatttcagccccaagaaattcaacttttgacttct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
25640734 |
caaaggaagctcagatcagattgggataaaatataaaaagtattatggcgaccacttgaccacatgattccagccccaagaaattcaacttttgactttt |
25640833 |
T |
 |
| Q |
116 |
ttcaaagcaagtaattaaagtggtccaatcataagcaagtaacttagtcattcacacttaaccattataactcatgtgacaagtgatgaaaaggttaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25640834 |
ttcaaagcaagtaattaaagtggtccaatcataagcaagtaacttagtcattcacacttaaccattataactcatgtgacaagtgatgaaaaggttaaaa |
25640933 |
T |
 |
| Q |
216 |
g |
216 |
Q |
| |
|
| |
|
|
| T |
25640934 |
g |
25640934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University