View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_50 (Length: 207)
Name: NF2722_low_50
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 96 - 196
Target Start/End: Complemental strand, 47645926 - 47645825
Alignment:
| Q |
96 |
ttgcagataatggttatacgactccatctgctttctgcattgt-actatacatgtacacgatcatttctcatcaaatgtagctaaagaaatattgctcaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47645926 |
ttgcagataatggttatacgactccatctgctttctgcattgttactatacatgtccacgatcatttctcatcaaatgtagctaaagaaatattgctcaa |
47645827 |
T |
|
| Q |
195 |
ac |
196 |
Q |
| |
|
|| |
|
|
| T |
47645826 |
ac |
47645825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 47646010 - 47645969
Alignment:
| Q |
12 |
ttgtttcatatattcacatcacagcaattaattcctatgatc |
53 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47646010 |
ttgtttcatatattcacatcacaacaattaattcctatgatc |
47645969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University