View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2723_high_20 (Length: 253)
Name: NF2723_high_20
Description: NF2723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2723_high_20 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 5522843 - 5522951
Alignment:
| Q |
5 |
gactgagatgaacatgtttggaagaaagggtgacagttttgcacatggagtccgagagcatggtatgtaatctccaaagattaatcttcaatgtttcacc |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5522843 |
gactaagatgaacatgtttggaagaaagggtgacagttttgcacatggagtccaagagcatggtatgtaatctccaaagattaatcttcaatgtttcacc |
5522942 |
T |
|
| Q |
105 |
tttgcttat |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
5522943 |
tttgcttat |
5522951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 180 - 253
Target Start/End: Complemental strand, 51753886 - 51753813
Alignment:
| Q |
180 |
tgtaactgatggcttgaaactgttattgtaacctgcagtgagattaggaccaaagataacagatacagtaaaag |
253 |
Q |
| |
|
|||| ||||| |||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
51753886 |
tgtacctgatagcttgaaactgttattttaccctgcagtgagacttggaccaaagataacagatacagtaaaag |
51753813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 5 - 112
Target Start/End: Complemental strand, 51754099 - 51753992
Alignment:
| Q |
5 |
gactgagatgaacatgtttggaagaaagggtgacagttttgcacatggagtccgagagcatggtatgtaatctccaaagattaatcttcaatgtttcacc |
104 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||| ||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
51754099 |
gactaagatgaacatgtttggaagaaaagatgatggttttgcacatggtatccgagagcatggtatgtaatcttggaagacctatcttcaatttttcact |
51754000 |
T |
|
| Q |
105 |
tttgctta |
112 |
Q |
| |
|
|||||||| |
|
|
| T |
51753999 |
tttgctta |
51753992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University