View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2723_high_22 (Length: 245)
Name: NF2723_high_22
Description: NF2723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2723_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 28536726 - 28536938
Alignment:
| Q |
17 |
agtaagggcagcactgcctcagaaatatatacagaaagtctctccttgtttaacctaacctagtgcagcccctaaaaccatatgttttgatgacgtgagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28536726 |
agtaagggcagcactgcctcagaaatatacacagaaagtctctccttgtttaacctaacctagtgcagcccctaaaaccatatgttttgatgacgtgagg |
28536825 |
T |
 |
| Q |
117 |
cgcataaatagaaggttcaagcaacaatgaaatgttcggaaaataaaatatgaaaaccatcaatctatggggtgattcccatatccaatctcaacccggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
28536826 |
cgcataaatagaaggttcaagcaacaatgaaatgttcggaaaat-aaatatgaaaaccatcaatctatggggtgattctcatatccaaactcaacccggt |
28536924 |
T |
 |
| Q |
217 |
taacattttcaaga |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28536925 |
taacattttcaaga |
28536938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University