View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2723_low_16 (Length: 349)
Name: NF2723_low_16
Description: NF2723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2723_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 6e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 7 - 145
Target Start/End: Original strand, 7609253 - 7609391
Alignment:
| Q |
7 |
tcgaagaaaatatgttggcaggatagaagggttgtcatgttgtttgtatatttcaaaagttttgggatggtcgtttctttttctcttaagttgttattgt |
106 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
7609253 |
tcgatgaatatatgttggcaggatagaagggttgtcatgttgattgtatattttgaaagttttgggatggtcctttctttttctcttaagttgtttttgt |
7609352 |
T |
|
| Q |
107 |
ttgatgattgtagagagattttcatccatgtttagttcc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609353 |
ttgatgattgtagagagattttcatccatgtttagttcc |
7609391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 250 - 333
Target Start/End: Original strand, 7609495 - 7609579
Alignment:
| Q |
250 |
atcttacggcgaaccaaattataataaattact-aatctctcttttagtatcttcacaagggatccctttctgagccaaaggagt |
333 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7609495 |
atcttacggtgaaccaaattataataaattactcaatctttcttttagtatcttcacaagggatccctttctgagccaaacgagt |
7609579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 135
Target Start/End: Original strand, 28559603 - 28559650
Alignment:
| Q |
88 |
tctcttaagttgttattgtttgatgattgtagagagattttcatccat |
135 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
28559603 |
tctcttaagttgttattttttgatgattgtagagggatttccatccat |
28559650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University