View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2723_low_17 (Length: 316)
Name: NF2723_low_17
Description: NF2723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2723_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 26153446 - 26153274
Alignment:
| Q |
19 |
cttttactcatctttccactctttctcaaattattcaattgataatttactattctatcaattgaaattgactattctataaaattttccattaacttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26153446 |
cttttactcatctttccactctttctcaaattattcaattgataatttactattctatcaattgaaattgactattctattaaattttccattaacttgt |
26153347 |
T |
 |
| Q |
119 |
ttgtttatcacggactttcagaaaaaatgagaatctaaacaagatttaagaactaagagttgtttcaagtagc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26153346 |
ttgtttatcacggactttcagaaaaaatgagaatctaaacaagatttaaaaactaagagttgtttcaagtagc |
26153274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 272 - 316
Target Start/End: Complemental strand, 26153172 - 26153128
Alignment:
| Q |
272 |
ccttaaatcttcttgatatcactttaaattattaaatatgaaagt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26153172 |
ccttaaatcttcttgatatcactttaaattattaaatatgaaagt |
26153128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University