View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2723_low_27 (Length: 237)
Name: NF2723_low_27
Description: NF2723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2723_low_27 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 34101389 - 34101625
Alignment:
| Q |
1 |
tgaagaagatgaaaaactacttccacgtgtacacgatttccaaacttaacgattttgcgaaaccgttacttcaagcacagattcctcacaatctccatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||| || |
|
|
| T |
34101389 |
tgaagaagatgaaaaactacttccacgtgtacacgatttccaaacttgacgattttgcgaaatcgttacttcaagcacagattccttacaatctccacat |
34101488 |
T |
|
| Q |
101 |
tgtgatggatcatgaaatcaaggagcgtctctgcttagagatcaacactctcaacctcagcgcgcttatcgttggaagggggcgagtattgcgttcgcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101489 |
tgtgatggatcatgaaatcaaggagcgtctctgcttagagatcaacagtctcaacctcagcgcgcttatcgttggaagggggcgagtattgcgttcgcca |
34101588 |
T |
|
| Q |
201 |
ttgcaaacgtcctgttgttgttgttggaagttctgat |
237 |
Q |
| |
|
|||| || ||||||||| |||||| |||||||||||| |
|
|
| T |
34101589 |
ttgcgaatgtcctgttggtgttgtgggaagttctgat |
34101625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University