View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2724_high_2 (Length: 504)

Name: NF2724_high_2
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2724_high_2
NF2724_high_2
[»] chr4 (4 HSPs)
chr4 (125-331)||(20154691-20154898)
chr4 (419-493)||(20154519-20154593)
chr4 (19-80)||(40036349-40036410)
chr4 (19-56)||(40045657-40045694)
[»] chr7 (3 HSPs)
chr7 (268-337)||(10057746-10057814)
chr7 (419-477)||(16893611-16893669)
chr7 (419-481)||(10057886-10057948)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 1e-94; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 125 - 331
Target Start/End: Complemental strand, 20154898 - 20154691
Alignment:
125 tgtttctccgtttttt-gccattagtagtaagtaacatcgtttattccgttatttctcaactcttcttgtcagcatgcttattgtcttcgtgtactttgc 223  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
20154898 tgtttctccgtttttttgccattagtagtaattaacatcgtttattccgttatttctcaacttttcttgtgagcatgcttattgtcttcgtgtactttgc 20154799  T
224 ccacctgtacaagtatcgcgcttcataattatatggacggaaatagtgtttgaagaaagtcaaagcttagtggaatttaagtgaaaggagtgatgcaaat 323  Q
    ||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20154798 ccatctgtacaagcatcgcgcttcataattatatggacggaaagagtgtttgaagaaagtcaaagcttagtggaatttaagtgaaaggagtgatgcaaat 20154699  T
324 agtattag 331  Q
    ||||||||    
20154698 agtattag 20154691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 419 - 493
Target Start/End: Complemental strand, 20154593 - 20154519
Alignment:
419 gcaaatttgtcactcattttgagatgaaaagagcacttactctcaatatttattgtcaagaattgttttgccttt 493  Q
    ||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||  |||||||| ||||||||    
20154593 gcaaatttgtcactcattttgggatgaaaagagtacttactcttaatatttattgtagagaattgtcttgccttt 20154519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 40036349 - 40036410
Alignment:
19 gtaatttgcttgcaatgactttggaactttcatatgtttctcttttattttaggtatgcagc 80  Q
    ||||||||||||||||||||||||| |||| ||||||||||| |||||||| ||||||||||    
40036349 gtaatttgcttgcaatgactttggatcttttatatgtttctcgtttattttgggtatgcagc 40036410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 40045657 - 40045694
Alignment:
19 gtaatttgcttgcaatgactttggaactttcatatgtt 56  Q
    ||||||||||||||||||||||||| |||| |||||||    
40045657 gtaatttgcttgcaatgactttggatcttttatatgtt 40045694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 337
Target Start/End: Original strand, 10057746 - 10057814
Alignment:
268 agtgtttgaagaaagtcaaagcttagtggaatttaagtgaaaggagtgatgcaaatagtattagctagag 337  Q
    ||||||| |||||||||||||||||||| |||||||| |||| |||||||||||||||||||| ||||||    
10057746 agtgtttaaagaaagtcaaagcttagtgaaatttaagcgaaa-gagtgatgcaaatagtattaactagag 10057814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 419 - 477
Target Start/End: Original strand, 16893611 - 16893669
Alignment:
419 gcaaatttgtcactcattttgagatgaaaagagcacttactctcaatatttattgtcaa 477  Q
    |||||||| |||||||||||| |||| |||||| |||||||||||||||||||||||||    
16893611 gcaaatttatcactcattttgggatggaaagagtacttactctcaatatttattgtcaa 16893669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 481
Target Start/End: Original strand, 10057886 - 10057948
Alignment:
419 gcaaatttgtcactcattttgagatgaaaagagcacttactctcaatatttattgtcaagaat 481  Q
    |||||||| ||||| |||||| |||| ||| || ||||| |||||||||||||||||||||||    
10057886 gcaaatttatcacttattttgggatggaaatagtacttattctcaatatttattgtcaagaat 10057948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University