View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2724_high_21 (Length: 248)
Name: NF2724_high_21
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2724_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 48187745 - 48187848
Alignment:
| Q |
1 |
ttaactagagtacctatatgggtaacattttaaatacactttgatgagtaaaaataaagactatatatgcaatttatttaattaaaataatttcaaacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
48187745 |
ttaactagagtacctatatgggtaacattttaaatacactttgatgagtaaaaataaagactataaatgcaatttatttaattaaaataacttcaaacaa |
48187844 |
T |
|
| Q |
101 |
gttt |
104 |
Q |
| |
|
|||| |
|
|
| T |
48187845 |
gttt |
48187848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University