View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2724_low_14 (Length: 303)
Name: NF2724_low_14
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2724_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 288
Target Start/End: Complemental strand, 22840481 - 22840203
Alignment:
| Q |
10 |
aaatgaatatgaggaaccttagtgaatatatccgtttataacatccaatatttttgtgacaaaatttgatctcccattttggttgtctatcttcccatgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22840481 |
aaatgaatatgaggaaccttagtgaatatatccgtttataacatccaatatttttgtgacaaaatttgatctcccattttggttgtctatcttcccatgg |
22840382 |
T |
 |
| Q |
110 |
acaaaatcaataattatctttttcttgaaggttgaagcctttcatgttggcttaatgtcatcatggggagtacaattcaatgttgatgctgactttcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22840381 |
acaaaatcaataattatctttttcttgaaggttgaagcctttcatgttggcttaatgtcatcatggggagtacaattcaatgttgatgctgactttcttt |
22840282 |
T |
 |
| Q |
210 |
ccttcattttcttagcaaatgagattgagttggtatgtcgtttaattaagatgcagggctacgaaattcgggttctaaa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22840281 |
ccttcattttcttagcaaatgagattgagttggtatgtcgtttaattaagatgcagggctacgaaattcgggttctaaa |
22840203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 288
Target Start/End: Original strand, 24630684 - 24630756
Alignment:
| Q |
212 |
ttcattttcttagcaaatgagattgagttggtatgtcgtttaattaagatgcagggctacgaaattcgggttctaaa |
288 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |||| |||||||||||||||||| ||| | |||||||||| |
|
|
| T |
24630684 |
ttcatttttttagcaaataagattgagttggtacgtcg----attaagatgcagggctacaaaactggggttctaaa |
24630756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 98
Target Start/End: Complemental strand, 27919894 - 27919811
Alignment:
| Q |
15 |
aatatgaggaaccttagtgaatatatccgtttataacatccaatatttttgtgacaaaatttgatctcccattttggttgtcta |
98 |
Q |
| |
|
|||||| |||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27919894 |
aatatggggaaccttagtgaagatatccatttataacatcgaatatctttgtgacaaaatttgatcccccattttggttgtcta |
27919811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University