View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2724_low_21 (Length: 252)
Name: NF2724_low_21
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2724_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 233
Target Start/End: Complemental strand, 686168 - 685963
Alignment:
| Q |
28 |
gttaattttagaacacttgtttaacacgtgtctgacactgaaacacgtctaatgtcaaagtgtatgtgccttgtagcatattggacattgggcttgctaa |
127 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
686168 |
gttaattttaaaacatttgtttaacacgtgtctgacactgaaacacgtctaatgtcaaagtgtatgtgcctcgtagcatattggacattgggcttgctaa |
686069 |
T |
 |
| Q |
128 |
gaatttatggattttgtctgtgtagggcccaaccctttcattgagtttgacttatcatacccaatttctagaaagcaatttgacaattgcttttctcata |
227 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
686068 |
gaatttatggactttgtctgtgtagggcccaaccatttcattgagttcgacatatcatacccaatttctagaaaacaatttgacaattgcttttctcata |
685969 |
T |
 |
| Q |
228 |
tttatt |
233 |
Q |
| |
|
| |||| |
|
|
| T |
685968 |
tctatt |
685963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University