View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2724_low_26 (Length: 247)
Name: NF2724_low_26
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2724_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 1161289 - 1161056
Alignment:
| Q |
12 |
ataggtgtattgttaacaaatcacgtcaattgaccactggcattgacttttccacaaataaacttctt-cttgnnnnnnnnagaaaataacttgtatcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1161289 |
ataggtgtattgttaacaaatcacgtcaattgaccactggcattgacttttccacaaataaacttcttactt---ttttttagaaaataacttgtatcaa |
1161193 |
T |
|
| Q |
111 |
tttccataaataaacttatgtaattctgtaaaaatannnnnnnnagcaaaatcagtgacttaaatgacgtgatcaaattgcttatttttattgaaaggga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1161192 |
tttccataaataaacttatgtaattctgtaaaaatattttttttagcaaaatcagtgacttaaatgacgtgatcaaattgcttatttttattgaaaggga |
1161093 |
T |
|
| Q |
211 |
ttcatttgtttattgtttatatcgtagatatctctcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1161092 |
ttcatttgtttattgtttatatcgtagatatctctcc |
1161056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University