View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2724_low_32 (Length: 205)
Name: NF2724_low_32
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2724_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 125 - 191
Target Start/End: Complemental strand, 20154898 - 20154831
Alignment:
| Q |
125 |
tgtttctccgtttttt-gccattagtagtaagtaacatcgtttattccgttatttctcaactcttctt |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20154898 |
tgtttctccgtttttttgccattagtagtaattaacatcgtttattccgttatttctcaacttttctt |
20154831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 40036349 - 40036410
Alignment:
| Q |
19 |
gtaatttgcttgcaatgactttggaactttcatatgtttctcttttattttaggtatgcagc |
80 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
40036349 |
gtaatttgcttgcaatgactttggatcttttatatgtttctcgtttattttgggtatgcagc |
40036410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 40045657 - 40045694
Alignment:
| Q |
19 |
gtaatttgcttgcaatgactttggaactttcatatgtt |
56 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
40045657 |
gtaatttgcttgcaatgactttggatcttttatatgtt |
40045694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University