View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2724_low_32 (Length: 205)

Name: NF2724_low_32
Description: NF2724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2724_low_32
NF2724_low_32
[»] chr4 (3 HSPs)
chr4 (125-191)||(20154831-20154898)
chr4 (19-80)||(40036349-40036410)
chr4 (19-56)||(40045657-40045694)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 125 - 191
Target Start/End: Complemental strand, 20154898 - 20154831
Alignment:
125 tgtttctccgtttttt-gccattagtagtaagtaacatcgtttattccgttatttctcaactcttctt 191  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||    
20154898 tgtttctccgtttttttgccattagtagtaattaacatcgtttattccgttatttctcaacttttctt 20154831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 40036349 - 40036410
Alignment:
19 gtaatttgcttgcaatgactttggaactttcatatgtttctcttttattttaggtatgcagc 80  Q
    ||||||||||||||||||||||||| |||| ||||||||||| |||||||| ||||||||||    
40036349 gtaatttgcttgcaatgactttggatcttttatatgtttctcgtttattttgggtatgcagc 40036410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 40045657 - 40045694
Alignment:
19 gtaatttgcttgcaatgactttggaactttcatatgtt 56  Q
    ||||||||||||||||||||||||| |||| |||||||    
40045657 gtaatttgcttgcaatgactttggatcttttatatgtt 40045694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University