View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2725_high_25 (Length: 248)
Name: NF2725_high_25
Description: NF2725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2725_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 35466333 - 35466568
Alignment:
| Q |
9 |
gaagaaaattatatgaaagatccaccatatgaactgtgtcaaaatctatccattgtgaaactaaagccgaaattgtaattaaaaaatcacaccgcataaa |
108 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35466333 |
gaagaaaattatctgaaagacgcaccatatgaaccgtgtcaaaatctatccattgtgaaaccaaagccgaaattgtaattaaaaaatcacaccgcataaa |
35466432 |
T |
 |
| Q |
109 |
tcaatccacatgctcgtaacaattgcaccctcccacacaaaattttgcattgttttgaagtaatacgatttcgaagcaattgccaagcaaataagcttac |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
35466433 |
tcaatccacatgctcgtagcaattgcaccctcccacacaaaattttgtattgttttgaaggaatatgattttgaagcaattgccaagcaaataagcttat |
35466532 |
T |
 |
| Q |
209 |
tttcgaagaaaacttcttatgccaaatcatgttatt |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35466533 |
tttcgaagaaaacttcttatgtcaaatcatgttatt |
35466568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University