View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2725_high_31 (Length: 237)
Name: NF2725_high_31
Description: NF2725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2725_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 29 - 221
Target Start/End: Original strand, 35467301 - 35467493
Alignment:
| Q |
29 |
ttaaactctaaagtgagagttgctcactttagagaagtcggatccaagttttcaccgtcacttagttgtaattaatctacgtataagaacatgtggaaca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
35467301 |
ttaaactctaaagtgagagttgctcactttagagaagtcggattcaagttttcaccgtcacttagttgtaattaatctaggtataagaacatgtgggaca |
35467400 |
T |
|
| Q |
129 |
cgctagatggattctcccctcccgatcaaatttttcatacgcaaatgccgaatatcgaaccataaccatctgtttaaggagctcaagttattt |
221 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
35467401 |
cgctagatgaattctcctctcccgatcaaatttttcatacgcaaacgccgaagatcgaaccataaccatttgtttaaggagctcaaattattt |
35467493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University