View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2725_low_35 (Length: 226)
Name: NF2725_low_35
Description: NF2725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2725_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 5 - 210
Target Start/End: Original strand, 46144242 - 46144450
Alignment:
| Q |
5 |
aaaaaggcactcctttttggatttggatggccacctcactccctagctagtccctaacaagatttggagaagtcagtgaaatttacataccctttctaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46144242 |
aaaaaggcactcctttttggatttggatggccacctcactccctag----tccctaacaagatttggagaagtcagtgaaatttacatacccttcctaaa |
46144337 |
T |
 |
| Q |
105 |
taataactaaagaaaggataaatatcactttacaatgctccaaagaaagagagaaaac-------nnnnnnngaggttagatgatatttaacagcaaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46144338 |
taataactaaagaaaggataaatatcactttacaatgctccaaagaaagagagaaaacaaaaaaaaaaaaaagaggttagatgatatttaacagcaaaat |
46144437 |
T |
 |
| Q |
198 |
gctaatttgttga |
210 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
46144438 |
gctaacttgttga |
46144450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University