View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2726_high_17 (Length: 334)
Name: NF2726_high_17
Description: NF2726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2726_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 326
Target Start/End: Original strand, 9833582 - 9833891
Alignment:
| Q |
17 |
ttgattaagggtggattccctagtggaaaatacttgttcgctggagtagttgatggaaggaacatttgggctaatgatcttacttcgtctctgattacat |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9833582 |
ttgattaaggggggattccctagtggaaaatacttgttcgctggagtagttgatggaaggaacatttgggctaatgatcttacttcttctctgattacat |
9833681 |
T |
|
| Q |
117 |
taaacgggctggaggagattgtcggcaaaggtatttcatcaaagatgcatttcgtgaatatttggctagaaaaaacttataagcatttaattaaactatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833682 |
taaacgggctggaggagattgtcggcaaaggtatttcatcaaagatgcatttcgtgaatatttggctagaaaaaacttataagcatttaattaaactatt |
9833781 |
T |
|
| Q |
217 |
tatccaaacagtcataatactgtcacttgaaatatctattttacaaaaacgtgtgcagataaactcgttgtgtcaacctcttgctcacttctccacactg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833782 |
tatccaaacagtcataatactgtcacttgaaatatctattttacaaaaacgtgtgcagataaactcgttgtgtcaacctcttgctcacttctccacactg |
9833881 |
T |
|
| Q |
317 |
ctgttcatct |
326 |
Q |
| |
|
||||| |||| |
|
|
| T |
9833882 |
ctgttgatct |
9833891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 97
Target Start/End: Complemental strand, 33468964 - 33468923
Alignment:
| Q |
56 |
gctggagtagttgatggaaggaacatttgggctaatgatctt |
97 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33468964 |
gctggagtcgttgatggaaggaacatctgggcaaatgatctt |
33468923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 194 - 226
Target Start/End: Complemental strand, 504145 - 504113
Alignment:
| Q |
194 |
tataagcatttaattaaactatttatccaaaca |
226 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
504145 |
tataagcacttaattaaactatttatccaaaca |
504113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University