View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2726_high_34 (Length: 212)
Name: NF2726_high_34
Description: NF2726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2726_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 39 - 191
Target Start/End: Original strand, 18857706 - 18857858
Alignment:
| Q |
39 |
aagtactatgatactattcagtagttaaataaatagttcaaacgtgaattcaggagaatatagaataaagatagcagaaccgtgctaagaagtaagaact |
138 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18857706 |
aagtactatgatactattcagtaattaaataaatagttcaaacgtgaattcgggagaatatagaataaagatagcagaaccgtgctaagaagtaagaact |
18857805 |
T |
 |
| Q |
139 |
caccgagagattatggaaacagatttgggagagaacgagtttgggtttggggt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18857806 |
caccgagagattatggaaacagatttgggagagaacgagtttgggtttggggt |
18857858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 40
Target Start/End: Original strand, 18857654 - 18857683
Alignment:
| Q |
11 |
gagtgagatgaaaatcgaatgatcaaataa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18857654 |
gagtgagatgaaaatcgaatgatcaaataa |
18857683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University