View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2726_low_15 (Length: 381)
Name: NF2726_low_15
Description: NF2726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2726_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 133 - 362
Target Start/End: Original strand, 3849605 - 3849838
Alignment:
| Q |
133 |
caaccatgcatggaagactattggcaatggcatcaattctgattttattcatttagttacaatccatgcatactcaatttttgataagattgtgtttgta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849605 |
caaccatgcatggaagactattggcaatggcatcaattctgattttattcatttggttacaatccatgcatactcaatttttgataagattgtgtttgta |
3849704 |
T |
 |
| Q |
233 |
tgccaaatgagatttaactttacgggactctgctctattcatgttccccccataaaagaatattctacttttcataactgaatataaaaattacaaatta |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849705 |
tgccaaatgagatttaactttacgggactctgctctattcatgttccccccataaaagaatattctacttttcataactgaatataaaaattacaaatta |
3849804 |
T |
 |
| Q |
333 |
aagagc----atagttaatttgacttgaatagta |
362 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
3849805 |
aagagcaggtatagttaatttgacttgaatagta |
3849838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 3849485 - 3849519
Alignment:
| Q |
13 |
tgaagcacgtgattatcttcttttgttggaagaag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849485 |
tgaagcacgtgattatcttcttttgttggaagaag |
3849519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University