View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2726_low_25 (Length: 282)
Name: NF2726_low_25
Description: NF2726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2726_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 9833887 - 9834160
Alignment:
| Q |
1 |
gatcttgttaacgagaccaagctggataatgagattaaatcatggctagcttttgctgcccaaaaagtcgttgaagtaaatgcattggccaaggcattgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833887 |
gatcttgttaacgagaccaagctggataatgagattaaatcatggctagcttttgctgcgcaaaaagtcgttgaagtaaatgcattggccaaggcattgg |
9833986 |
T |
|
| Q |
101 |
ctggtcaaaaggatgaggtaatcaaccttcttttcctttatcatacatcaaacaaaacttgataacaaaattgcatcttagttaatttttatctatcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833987 |
ctggtcaaaaggatgaggtaatcaaccttcttttcctttatcatacatcaaacaaaacttgataacaaaattgcatcttagttaatttttatctatcttc |
9834086 |
T |
|
| Q |
201 |
caacttatttaatttttgttttaattcattattcactcaatcaaatcattgtttcatttgcaggccttcatctc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9834087 |
caacttatttaatttttgttttaattcattattcactcaatcaaatcattgtttcatttgcaggccttcttctc |
9834160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 33468734 - 33468613
Alignment:
| Q |
1 |
gatcttgttaacgagaccaagctggataatgagattaaatcatggctagcttttgctgcccaaaaagtcgttgaagtaaatgcattggccaaggcattgg |
100 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||| ||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||| | | |
|
|
| T |
33468734 |
gatctcgttaacgagaccaagttggatgatgaaattaagtcatggttagcttttgctgcccaaaaagttgttgaagtaaatgcattggccaatgcacttg |
33468635 |
T |
|
| Q |
101 |
ctggtcaaaaggatgaggtaat |
122 |
Q |
| |
|
| || | |||||||||||||| |
|
|
| T |
33468634 |
caggcaacaaggatgaggtaat |
33468613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 13 - 120
Target Start/End: Original strand, 35946814 - 35946921
Alignment:
| Q |
13 |
gagaccaagctggataatgagattaaatcatggctagcttttgctgcccaaaaagtcgttgaagtaaatgcattggccaaggcattggctggtcaaaagg |
112 |
Q |
| |
|
|||||||||||||| | || |||||||| ||||| |||||||| || |||||| | |||||||||||||| ||| ||||||||||| |||| ||||||| |
|
|
| T |
35946814 |
gagaccaagctggaccaagaaattaaatcttggcttgcttttgcagcacaaaaaatagttgaagtaaatgccttgtccaaggcattgtctggacaaaagg |
35946913 |
T |
|
| Q |
113 |
atgaggta |
120 |
Q |
| |
|
|||||||| |
|
|
| T |
35946914 |
atgaggta |
35946921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University