View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2726_low_27 (Length: 267)
Name: NF2726_low_27
Description: NF2726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2726_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 55102413 - 55102186
Alignment:
| Q |
19 |
atctaaggaaactgagggatcagcagtcagaaatgagctacaagtgtaaccaggacctggggccatgaatgtaacattattaggagcttgtccaagtgaa |
118 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102413 |
atctaaggacactgagggatcagaagtcagaaatgagctacaagtgtaaccaggacctggggccatgaatgtaacattattaggagcttgtccaagtgaa |
55102314 |
T |
 |
| Q |
119 |
ttttctttttcctccaagtttcttacttcaagttcaaatgaagacaatgaattgaaagaatcaacggctcgggcagagaggcggccaccacgacagcaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55102313 |
ttttctttttcctccaagtttcttacttcaagttcaaatgaagacaatgaattgaaagaatcaacagctcgggcagagaggcggccaccacgacagcaat |
55102214 |
T |
 |
| Q |
219 |
ggtctgacctgttttgtgacacatctgg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
55102213 |
ggtctgacctgttttgtgacacatctgg |
55102186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University