View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727-Insertion-6 (Length: 71)
Name: NF2727-Insertion-6
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 28102123 - 28102060
Alignment:
| Q |
8 |
gttactctttgctatgaggctcttgctagggctactgaccctgtttatggttgtgttgctcacc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102123 |
gttactctttgctatgaggctcttgctagggctactgaccctgtttatggttgtgttgctcacc |
28102060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 13286967 - 13287029
Alignment:
| Q |
8 |
gttactctttgctatgaggctcttgctagggctactgaccctgtttatggttgtgttgctcac |
70 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13286967 |
gttactctttgctatgaagctcttgctagggctagagaccctgtttatggttgtgttgctcac |
13287029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University