View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727R-Insertion-10 (Length: 178)
Name: NF2727R-Insertion-10
Description: NF2727R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727R-Insertion-10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 178
Target Start/End: Original strand, 46851640 - 46851810
Alignment:
| Q |
8 |
actcattactaggatctcgaaccggtaagtaaaattgataattctcctccgaagaacttgtcaaattccgtgtctttcattgcgctttttatgtttaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46851640 |
actcattactaggatctcgaaccggtaagtaaaattgataattctcctccgaagaacttgtcaaattccgtgtctttcattgcgctttttatgtttaatt |
46851739 |
T |
|
| Q |
108 |
gttgattttgagtagaaattcaggttgaacttgtttacaatgtttcaattttttgaggtgatgaattgata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46851740 |
attgattttgagtagaaattcaggttgaacttgtttacaatgtttcaattttttgaggtgatgaattgata |
46851810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University