View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727R-Insertion-11 (Length: 176)
Name: NF2727R-Insertion-11
Description: NF2727R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727R-Insertion-11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 8 - 160
Target Start/End: Complemental strand, 18857858 - 18857706
Alignment:
| Q |
8 |
accccaaacccaaactcgttctctcccaaatctgtttccataatctctcggtgagttcttacttcttagcacggttctgctatctttattctatattctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18857858 |
accccaaacccaaactcgttctctcccaaatctgtttccataatctctcggtgagttcttacttcttagcacggttctgctatctttattctatattctc |
18857759 |
T |
|
| Q |
108 |
ctgaattcacgtttgaactatttatttaactactgaatagtatcatagtactt |
160 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18857758 |
ccgaattcacgtttgaactatttatttaattactgaatagtatcatagtactt |
18857706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University