View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727R-Insertion-12 (Length: 140)
Name: NF2727R-Insertion-12
Description: NF2727R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727R-Insertion-12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 9 - 140
Target Start/End: Complemental strand, 4705442 - 4705311
Alignment:
| Q |
9 |
gaataatcatgctttcgagcatatttgttgccacaataactggcttttgcattctgtggcatcttctaatgatgtcctcctgttttattaaaaacgggat |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705442 |
gaataatcatgctttcaagcatatttgttgccacaataactggcttttgcattctgtggcatcttctaatgatgtcctcctgttttattaaaaacgggat |
4705343 |
T |
|
| Q |
109 |
tgaactacatagaacatggagttaaacatagt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4705342 |
tgaactacatagaacatggagttaaacatagt |
4705311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University