View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727R-Insertion-14 (Length: 44)
Name: NF2727R-Insertion-14
Description: NF2727R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727R-Insertion-14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 33821611 - 33821646
Alignment:
| Q |
9 |
gaaatttaccttaaaccccaattcccgattcctgtt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33821611 |
gaaatttaccttaaaccccaattcccgattcttgtt |
33821646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University