View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_16 (Length: 399)
Name: NF2727_high_16
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 40 - 244
Target Start/End: Original strand, 46726434 - 46726638
Alignment:
| Q |
40 |
gtgagtagatgtggtggatatgataagtacagggattattcgaagcgggtgtatgcgtcggacgaagctagaatcgaagcaatggagaatgctgataagt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46726434 |
gtgagtagatgtggtggatatgataagtacagggattattcgaagcgggtgtatgcgtcggacgaagctagaatggaagcaatggagaaggctgataagt |
46726533 |
T |
|
| Q |
140 |
tgctgtccgatttagattctgatcatccaacttttgtcaagtcaatgctccaatctcatgtcactggtggattctggctggtataatttctattctatta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46726534 |
tgctgtccgatttagattctgatcatccaacttttgtcaagtcaatgctccaatctcatgtcactggtggattctggctggtataatttctattctagta |
46726633 |
T |
|
| Q |
240 |
agcac |
244 |
Q |
| |
|
||||| |
|
|
| T |
46726634 |
agcac |
46726638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 318 - 384
Target Start/End: Original strand, 46726713 - 46726779
Alignment:
| Q |
318 |
atgaagcttactttgcatcactgaaagtttacaatttattacaaggttgttaaaaaatgggcctttg |
384 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
46726713 |
atgaagctcactttgcatcactgaaagtttacaattttttataaggttgttaaaaaatgggcctttg |
46726779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University