View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_20 (Length: 347)
Name: NF2727_high_20
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 296
Target Start/End: Complemental strand, 46726281 - 46726001
Alignment:
| Q |
16 |
agatgaaatggtgaatgtgggttagggtttacagttacagacttctttgtaaacaggagcaggcatattggcgacacggccggatcttcgaacaacaacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726281 |
agatgaaatggtgaatgtgggttagggtttacagttacagacttctttgtaaacaggagcaggcatattggcgacacggccggatcttcgaacaacaacg |
46726182 |
T |
|
| Q |
116 |
agctctttcttgataggagtgcgaggtttggaaggtgagggttttgaaatgggggaagatgatttgtgaagagattgagagagcttggtaagattcagag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46726181 |
agctctttcttgataggagtgcgaggtttggaaggtgagggttttgaaatgggggaagatgatttgtgaagagattgagagagcttggtaagactcagag |
46726082 |
T |
|
| Q |
216 |
cttccattctcttttgattctcttccattctcttgcggcgactctcttcgtatgatgatgcttttgccaccattttgattt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726081 |
cttccattctcttttgattctcttccattctcttgcggcgactctcttcgtatgatgatgcttttgccaccattttgattt |
46726001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University