View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_22 (Length: 333)
Name: NF2727_high_22
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2727_high_22 |
![](./plan/images/spacer.gif) | ![NF2727_high_22](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 23084591 - 23084274
Alignment:
Q |
1 |
acccttttctctctcaaacaatggctattcagcaacaaccctctcatgtcactaaaagtaaaaattctatggaagtctttaccacgatgtatccacnnnn |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23084591 |
acccttttctctctcaaacaatggctattcagcaacaaccctctcatgtcactaaaagtaaaaattctatggaagtctttaccacgatgtatccactttt |
23084492 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
nnnnac-actcttggcttttgtttatgtggagataacaggttttgccgacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcac |
199 |
Q |
|
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
T |
23084491 |
tttttccactcttggcttttgtttatgt--agataacaggttttgccgacaactttgtggagaataatctcattgtcatgagattgttattagttttcac |
23084394 |
T |
![](./plan/images/spacer.gif) |
Q |
200 |
agttatcacttttctcatcattataattccttccatcttagaaaacccgcctattcctatagttaaaatcgttgctatgatcgtcatgccttgtgtgtcg |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
23084393 |
agttatcacttttctcatcattataattccttccatcttagaaaacccgcctattcctatagttaaaatcgttgctatgattgtcatgccttgtgtgtcg |
23084294 |
T |
![](./plan/images/spacer.gif) |
Q |
300 |
tgtgtttcatcggtacttat |
319 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
23084293 |
tgtgtttcatcggtacttat |
23084274 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 147 - 319
Target Start/End: Original strand, 1526579 - 1526734
Alignment:
Q |
147 |
gacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcacagttatcacttttctcatcattataattccttccatcttagaaaacc |
246 |
Q |
|
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
1526579 |
gacaattttgtggagaaaaatctgattgtcatgagattgttgttagttttcacagttatcacttttctcatcatta-----------------gaaaacc |
1526661 |
T |
![](./plan/images/spacer.gif) |
Q |
247 |
cgcctattcctatagttaaaatcgttgctatgatcgtcatgccttgtgtgtcgtgtgtttcatcggtacttat |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1526662 |
cgcctattcctatagttaaaatcgttgctatgattgtcatgccttgtgtgtcgtgtgtttcatcggtacttat |
1526734 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 150 - 223
Target Start/End: Original strand, 1530993 - 1531066
Alignment:
Q |
150 |
aactttgtggagaaaaatctcattgtcatgagattgttgttagttttcacagttatcacttttctcatcattat |
223 |
Q |
|
|
|||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1530993 |
aactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattat |
1531066 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 1529778 - 1529819
Alignment:
Q |
182 |
attgttgttagttttcacagttatcacttttctcatcattat |
223 |
Q |
|
|
|||||||||||||||||| ||||| |||||||||||| |||| |
|
|
T |
1529778 |
attgttgttagttttcactgttattacttttctcatcgttat |
1529819 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 105 - 157
Target Start/End: Original strand, 1529725 - 1529777
Alignment:
Q |
105 |
acactcttggcttttgtttatgtggagataacaggttttgccgacaactttgt |
157 |
Q |
|
|
|||||| |||||||||||||| | ||||||||| |||||| ||||||||||| |
|
|
T |
1529725 |
acactcatggcttttgtttattttgagataacatgttttggtgacaactttgt |
1529777 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 4e-26; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 122 - 254
Target Start/End: Original strand, 43623758 - 43623890
Alignment:
Q |
122 |
ttatgtggagataacaggttttgccgacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcacagttatcacttttctcatcatt |
221 |
Q |
|
|
|||| |||||||||||||| ||| || ||||||||||||||||||||||| || |||||||||||||||||||||||| | ||| |||||||||| || |
|
|
T |
43623758 |
ttatttggagataacaggtcttggtgataactttgtggagaaaaatctcatcgttatgagattgttgttagttttcacatctttcaattttctcatcgtt |
43623857 |
T |
![](./plan/images/spacer.gif) |
Q |
222 |
ataattccttccatcttagaaaacccgcctatt |
254 |
Q |
|
|
||| || || || |||||||| |||| |||||| |
|
|
T |
43623858 |
atattttctaccctcttagaacacccacctatt |
43623890 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 122 - 254
Target Start/End: Complemental strand, 43995248 - 43995116
Alignment:
Q |
122 |
ttatgtggagataacaggttttgccgacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcacagttatcacttttctcatcatt |
221 |
Q |
|
|
|||| |||||||||||||| ||| || ||||||||||||||||||||||| || |||||||||||||||||||||||| | ||| |||||||||| || |
|
|
T |
43995248 |
ttatttggagataacaggtcttggtgataactttgtggagaaaaatctcatcgttatgagattgttgttagttttcacatctttcaattttctcatcgtt |
43995149 |
T |
![](./plan/images/spacer.gif) |
Q |
222 |
ataattccttccatcttagaaaacccgcctatt |
254 |
Q |
|
|
||| || || || |||||||| |||| |||||| |
|
|
T |
43995148 |
atattttctaccctcttagaacacccacctatt |
43995116 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 106 - 267
Target Start/End: Original strand, 26412045 - 26412195
Alignment:
Q |
106 |
cactcttggcttttgtttatgtggagataacaggttttgccgacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcacagttat |
205 |
Q |
|
|
||||| |||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||| |||| || | |
|
|
T |
26412045 |
cactcatggcttttgtttatacagagataacaagttttgctgacaactttgtggagaaaaatctc-----------attgttgttagtttccacaatttt |
26412133 |
T |
![](./plan/images/spacer.gif) |
Q |
206 |
cacttttctcatcattataattccttccatcttagaaaacccgcctattcctatagttaaaa |
267 |
Q |
|
|
|| ||||||||||| |||| | ||| |||||||||||||||| ||||||| ||||||||||| |
|
|
T |
26412134 |
caattttctcatcagtatactacctgccatcttagaaaacccacctattcgtatagttaaaa |
26412195 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 122 - 200
Target Start/End: Complemental strand, 30217202 - 30217124
Alignment:
Q |
122 |
ttatgtggagataacaggttttgccgacaactttgtggagaaaaatctcattgtcatgagattgttgttagttttcaca |
200 |
Q |
|
|
|||| |||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
30217202 |
ttatttggagataacaggttttggtgataactttgtggagaaaaatctcattgttatgagattgttgttagttttcaca |
30217124 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6434 times since January 2019
Visitors: 1273