View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_24 (Length: 301)
Name: NF2727_high_24
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 33821611 - 33821754
Alignment:
| Q |
18 |
gaaatttaccttaaaccccaattcccgattcctgttcctttgccacaccattcatgattcaaccacaatttatggcttttcttatgccacaaatcaaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33821611 |
gaaatttaccttaaaccccaattcccgattcttgttcctttgccacaccattcatgattcgaccacaatttatggcttttcttatgcaacaaatcaaatc |
33821710 |
T |
 |
| Q |
118 |
taccctcattaaccattttgatgaaaaaattgcaactataaaaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33821711 |
taccctcattaaccattttgatgaaaaaattgcaactataaaaa |
33821754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 178 - 290
Target Start/End: Original strand, 33821813 - 33821925
Alignment:
| Q |
178 |
tataaaacaaacacagatctacagcttttcaattgatcaagtcaaatttgacaatttgatagagctgcaaaccaaagtactagaaaattcaagttgcatt |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33821813 |
tataaaacaaacagagatctacagcttttcaattgatcaagtcaaatttgacaatttgatagagctgcaaaccaaagtactagaaaattcaagttgcatt |
33821912 |
T |
 |
| Q |
278 |
actttaactctgt |
290 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33821913 |
actttaactctgt |
33821925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University