View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_26 (Length: 271)
Name: NF2727_high_26
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 57 - 254
Target Start/End: Complemental strand, 7416787 - 7416590
Alignment:
| Q |
57 |
tgcattgcattgcatcgcatctttttccttcaatcaaaaatctgcatagtaatagtataattacattattgcgtataaatggtgaattagaagtagcatt |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416787 |
tgcattgcattgcattgcatctttttccttcaatcaaaaatctgcatagtaatagtataattacattattgcgtataaatggtgaattagaagtagcatt |
7416688 |
T |
 |
| Q |
157 |
tacaccaactacttctctgaacaaacaataaaatgaggcaccataatagacaatccatgaacaatggatgtctacttcgaaatgctagagttggaaaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416687 |
tacaccaactacttctctgaacaaacaataaaatgaggcaccataatagacaatccatgaacaatggatgtctacttcgaaatgctagagttggaaaa |
7416590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 52765639 - 52765575
Alignment:
| Q |
126 |
tgcgtataaatggtgaattagaagtagcatttacaccaactacttctctgaacaaacaataaaat |
190 |
Q |
| |
|
|||| |||||||| ||||| || |||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52765639 |
tgcgcataaatggagaattgcaactagcatttacaccaactacttctctgaaaaaccaataaaat |
52765575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University