View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2727_high_29 (Length: 236)

Name: NF2727_high_29
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2727_high_29
NF2727_high_29
[»] chr3 (2 HSPs)
chr3 (33-222)||(8137399-8137588)
chr3 (1-36)||(8137641-8137676)
[»] chr2 (1 HSPs)
chr2 (1-29)||(33564924-33564952)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 33 - 222
Target Start/End: Complemental strand, 8137588 - 8137399
Alignment:
33 tttaaataaacagaaaatcaccatgaacagaatctaagttcaaataataatagcaaa-cactgcaaataaactggcccttatgttggaatatttattaac 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||    
8137588 tttaaataaacagaaaatcaccatgaacagaatctaagttcaaataataatagcaaaacactgcaaataaactggcccttatgttggaatatgtattaac 8137489  T
132 aaggaaatgagtaattgaatacattgttgctaatgctatctatgtggtggtccatgtaacaaaataaaatatactatgtgatggtatgaac 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
8137488 aaggaaatgagtaattgaatacattgttgctaatgctatctatgtggtggtccatgtaacaaaat-aaatatactatgtgatggtatgaac 8137399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 8137676 - 8137641
Alignment:
1 gttgtgtgagtttaatttcaatggcttaccacttta 36  Q
    ||||||||||||||||||||||||||||||||||||    
8137676 gttgtgtgagtttaatttcaatggcttaccacttta 8137641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33564952 - 33564924
Alignment:
1 gttgtgtgagtttaatttcaatggcttac 29  Q
    |||||||||||||||||||||||||||||    
33564952 gttgtgtgagtttaatttcaatggcttac 33564924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University