View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_high_29 (Length: 236)
Name: NF2727_high_29
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 33 - 222
Target Start/End: Complemental strand, 8137588 - 8137399
Alignment:
| Q |
33 |
tttaaataaacagaaaatcaccatgaacagaatctaagttcaaataataatagcaaa-cactgcaaataaactggcccttatgttggaatatttattaac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8137588 |
tttaaataaacagaaaatcaccatgaacagaatctaagttcaaataataatagcaaaacactgcaaataaactggcccttatgttggaatatgtattaac |
8137489 |
T |
|
| Q |
132 |
aaggaaatgagtaattgaatacattgttgctaatgctatctatgtggtggtccatgtaacaaaataaaatatactatgtgatggtatgaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8137488 |
aaggaaatgagtaattgaatacattgttgctaatgctatctatgtggtggtccatgtaacaaaat-aaatatactatgtgatggtatgaac |
8137399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 8137676 - 8137641
Alignment:
| Q |
1 |
gttgtgtgagtttaatttcaatggcttaccacttta |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8137676 |
gttgtgtgagtttaatttcaatggcttaccacttta |
8137641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33564952 - 33564924
Alignment:
| Q |
1 |
gttgtgtgagtttaatttcaatggcttac |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33564952 |
gttgtgtgagtttaatttcaatggcttac |
33564924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University