View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_low_24 (Length: 314)
Name: NF2727_low_24
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 298
Target Start/End: Original strand, 37832899 - 37833172
Alignment:
| Q |
11 |
atcatcaagcataaacaaatttgtgaagtaaggaatgaaagagaaaggtgtgatggaacgcattctccattgtagtgcccctaacacaagtgcttccatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37832899 |
atcatcaagcataaacaaatttgtgaagtaaggaatgaaagagaaaggtgtgatggaacgcattctccattgtagtgcccctaacacaagtgcttccatt |
37832998 |
T |
 |
| Q |
111 |
ctttttattgtttgtgtctcaaaaatgaaaccaccatcaccatgattcataagagcctatcaaaaataatatcaatctctcttataaaaaactttggttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37832999 |
ctttttattgtttgtgtctcaaaaatgaaaccaccatcaccatgattcataagagcctatcaacaataatatcaat-------------aactttggttt |
37833085 |
T |
 |
| Q |
211 |
aaaattttaataattttttacct-tataggtaaagnnnnnnnnacctgaacatcagtagcagagtactctgttttcaacatctttactg |
298 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37833086 |
aaaatttcaataattttttacctatat-ggtaaag-tttttttacctgaacatcagtagcagagtactctgttttcaacatctttactg |
37833172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University