View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_low_28 (Length: 259)
Name: NF2727_low_28
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 28102342 - 28102118
Alignment:
| Q |
17 |
gagatgaatttgggatgtggtgatgagggtggtggaccttgtggagcctgcaagtttttgagaagaaagtgtgtgaaaggttgttgcatatttgcaccat |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102342 |
gagatggatttgggatgtggtgatgagggtggtggaccttgtggagcctgcaagtttttgaggagaaagtgtgtgaaaggttgttgcatatttgcaccat |
28102243 |
T |
 |
| Q |
117 |
attttgagtcatcaggtcaaggaagtgctcattttgctgcagttcataaggtttttggtgctagcaatgctgctaaactactcacacgtattccagttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102242 |
attttgagtcatcaggtcaaggaagtgctcattttgctgcagttcataaggtttttggtgctagcaatgctgctaaactactcacacgtattccagttca |
28102143 |
T |
 |
| Q |
217 |
taagcgtcttgatgctgttgttact |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28102142 |
taagcgtcttgatgctgttgttact |
28102118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 44 - 241
Target Start/End: Original strand, 13286781 - 13286972
Alignment:
| Q |
44 |
ggtggtggaccttgtggagcctgcaagtttttgagaagaaagtgtgtgaaaggttgttgcatatttgcaccatattttgagtcatcaggtcaaggaagtg |
143 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||| ||| | ||||||| | |
|
|
| T |
13286781 |
ggtggtgggccttgtggtgcttgcaagtttttgaggagaaagtgtgtaaaaggttg---catatttgcaccatattttgattca---gaccaaggaacgg |
13286874 |
T |
 |
| Q |
144 |
ctcattttgctgcagttcataaggtttttggtgctagcaatgctgctaaactactcacacgtattccagttcataagcgtcttgatgctgttgttact |
241 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||| ||||| |||| |||||| |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
13286875 |
ttcattttgcagcagttcataaagtgtttggtgctagtaatgcctctaagttactcatgcgtattccagctcataaacgtcttgatgctgttgttact |
13286972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University