View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2727_low_30 (Length: 244)
Name: NF2727_low_30
Description: NF2727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2727_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 2384877 - 2385103
Alignment:
| Q |
1 |
tcgaccgatggcaaggcgtttcatttcaactagagctgcgataatcatcgctatgattgagagaaccattccgattcccatcctttgcatcacgttgata |
100 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||| |
|
|
| T |
2384877 |
tcgaccgatagcaagacgtttcatttcaactagtgctgcgataatcatcgctatgattgagagtaccattccgattcccattctttgcatcacatttata |
2384976 |
T |
 |
| Q |
101 |
cctttttcttgtcgtgttatcagttgagcaaacggtatgaaaattctgtcgtataacggcatcaatagtataatggacaaggttatagcactttggagtg |
200 |
Q |
| |
|
|||||||| |||||||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
2384977 |
cctttttcctgtcgtgttatcagctgcgcgaacggtatgaaaattctgttgtataacggcatcaatagtattatagacaatgttatagcactttggagtg |
2385076 |
T |
 |
| Q |
201 |
tggcgggtggtatcttgaaatttgaac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2385077 |
tggcgggtggtatcttgaaatttgaac |
2385103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University