View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728-Insertion-3 (Length: 206)
Name: NF2728-Insertion-3
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 34479311 - 34479116
Alignment:
| Q |
10 |
atgtataataattaatgaattattaccagtttgggaccatagaagaagataccataaaatactaacaacactaatgtcatgaactctataatcggttgga |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34479311 |
atgtataataattaatgaattatttccagtttgggaccatagaagaagataccataaaatactaacaacactaatgtcatgaactctataatcggttgga |
34479212 |
T |
 |
| Q |
110 |
ttgtttgtcatatgggatatatataattgcacattattacataagaaagtgatgcaccatttgactttagcaatcagttactctca-acaaagttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
34479211 |
ttgtttgtcatatgggatatatataattgcacattattacataagaaagtgatgcaccatttgactttagcaatcagtaactctcacacaaagttg |
34479116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University