View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728R-Insertion-9 (Length: 205)
Name: NF2728R-Insertion-9
Description: NF2728R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728R-Insertion-9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 67 - 205
Target Start/End: Original strand, 14540276 - 14540414
Alignment:
| Q |
67 |
acttcacaattaactacaatacatcttcgttttaaggctttcgttgaagcaattctgccctgcagaactcatcttccatgaatgatgaattttgatggaa |
166 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14540276 |
acttcacaattagctacaatacaccttcgttttaaggctttcgtcgaagcaattctgccttgcagaactcatcttccatgaatgatgaattttgatggaa |
14540375 |
T |
|
| Q |
167 |
ccgatgaattccacaactatttatagactttcttgtttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14540376 |
ccgatgaattccacaactatttataggctttcttatttc |
14540414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 37 - 205
Target Start/End: Original strand, 14541790 - 14541958
Alignment:
| Q |
37 |
gcggcttccaaaccaaacacacaaggaataacttcacaattaactacaatacatcttcgttttaaggctttcgttgaagcaattctgccctgcagaactc |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||||||| |||||||||| |||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
14541790 |
gcggcttccgaaccaaacacacaaggaattacctcacaattagctacaatacaccttcgttttaaggccttcgtcgaagcaattcagccctgcagaactt |
14541889 |
T |
|
| Q |
137 |
atcttccatgaatgatgaattttgatggaaccgatgaattccacaactatttatagactttcttgtttc |
205 |
Q |
| |
|
| |||| ||||||||||||| ||||||||||||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
14541890 |
gccatccacgaatgatgaatttcaatggaaccgatgaattccataactatttataggctttctcgtttc |
14541958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University