View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_high_18 (Length: 283)
Name: NF2728_high_18
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 43407809 - 43408057
Alignment:
| Q |
8 |
gagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnna |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43407809 |
gagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggag------a |
43407902 |
T |
|
| Q |
108 |
tcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcacaa |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43407903 |
tcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaa |
43408002 |
T |
|
| Q |
208 |
tacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408003 |
tacatgtccaacaataataatattcctatgggaatgggagagggagatcacttca |
43408057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University