View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_high_25 (Length: 210)
Name: NF2728_high_25
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 7 - 195
Target Start/End: Original strand, 32224196 - 32224384
Alignment:
| Q |
7 |
agaagcaaagggagagaaagagaaagtagatagatagcaatgatgatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtg |
106 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224196 |
agaaccaaagagagagaaagagaaagtagatagatagcaatgatgatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtg |
32224295 |
T |
|
| Q |
107 |
gtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggtcaacggatccatcatgat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224296 |
gtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggtcaacggatccatcatgat |
32224384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University