View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_high_8 (Length: 420)
Name: NF2728_high_8
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 401
Target Start/End: Complemental strand, 43585518 - 43585124
Alignment:
| Q |
1 |
aaggttttcaagttctatttgcctagataatgaaaccacaccactttgtttctcatatgattacccggataaaataattgatatttcacaatgattaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585518 |
aaggttttcaagttctatttgcctagataatgaaaccacaccactttgtttctcatatgattacccggataaaataattgatatttcacaatgattaatt |
43585419 |
T |
|
| Q |
101 |
ctggtgtaatgcatgcaagttgttgtcaattcagtgctacagtcttggaagaggatgagaggggtatactatttgcactgtattgtctgaagaatgagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585418 |
ctggtgtaatgcatgcaagttgttgtcaattcagtgctacagtcttggaagaggatgagaggggtatactatttgcactgtattgtctgaagaatgagtg |
43585319 |
T |
|
| Q |
201 |
ttggtggttgaagatagtaatctagctagggtacatatttgaagagagaaggaaaaccctaaggatgaacaactgtctactactattttttctgtgttga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585318 |
ttggtggttgaagatagtaatctagctagggtacatatttgaagagagaaggaaaaccctaaggatgaacaactgtctactactattttttctgtgttga |
43585219 |
T |
|
| Q |
301 |
ttgagttgaggaatcaaacaaaggatacaaactgtggctcactatttgagagggtgcgatannnnnnnatatgattaaagaaaatgtggggatgaagatc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43585218 |
ttgagttgaggaatcaaacaaaggatacaaactgtggctcactatttgaga------gatatttttttatatgattaaagaaaatgtggggatgaagatc |
43585125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University