View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_low_14 (Length: 359)
Name: NF2728_low_14
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 8 - 343
Target Start/End: Complemental strand, 38814125 - 38813790
Alignment:
| Q |
8 |
cgaagaatattaagcagtgatttgtggacagaatcatatgcccaactctcaaagcaattgaaaccatttaggtgaatgataagacacgagtgtccatcac |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814125 |
cgaagaaaattaagcagtgatttgtggacagaatcatatgcccaactctcaaagcaattgaaaccatttaggtgaatgataagacacgagtgtccatcac |
38814026 |
T |
 |
| Q |
108 |
agagctgcagggttgcacatttggatttggtaactgttcctggctccgtgccatgtaacagaagccattcagcatcaagcccgataactttggttcgatg |
207 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814025 |
agaactgcagtgttgcacatttggatttggtaactgttcctggctccgtgccatgtaacagaagccattcagcatcaagcccgataactttggttcgatg |
38813926 |
T |
 |
| Q |
208 |
actgttagaacgatgcaagaacgatcttatatgattctcaatcttttgctcatcggatgttgctcgagtcttgatgtgtactccattcagctcaaacgat |
307 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38813925 |
attgttagaacgatgcaagaacgatcttatatgattctcaatcttttgctcatcggatgttgctctggtcttgatgtgtactccattcagctcaaacgat |
38813826 |
T |
 |
| Q |
308 |
cccacataacccatgtgtgctgaagaagtttgtaag |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38813825 |
cccacataacccatgtgtgctgaagaagtttgtaag |
38813790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University