View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_low_16 (Length: 322)
Name: NF2728_low_16
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 118 - 304
Target Start/End: Complemental strand, 54930034 - 54929848
Alignment:
| Q |
118 |
ttttttaatatagtaattataattgaatgaatcgttgatggctctataaagttccaaatttctggaatcgatgattcttattttttgacctaaccnnnnn |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54930034 |
ttttttaatatagtaattataattgaatgaatcgttgatggctctataaagttccaaatttctggaatcgatgattcttattttttgacctaaccaaaaa |
54929935 |
T |
 |
| Q |
218 |
nnnnnnngctggcccggtccaatgcaagtgtgtacgagcgagccggcacaaaacnnnnnnnncgttaaaatcactcacgccggtttt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54929934 |
ataaaaagctggcccggtccaatgcaagtgtgtacgagcgagccggcacaaaacaaaaaaaacgttaaaatcactcacgccggtttt |
54929848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 38933085 - 38933053
Alignment:
| Q |
18 |
attcagacctttatttagaagtttgtttgagag |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38933085 |
attcagacctttatttagaagtttgtttgagag |
38933053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 80
Target Start/End: Complemental strand, 38933042 - 38933010
Alignment:
| Q |
48 |
gaggactaattatatatacctgatttccctctg |
80 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
38933042 |
gaggacaaattatatatacctgatttccctctg |
38933010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University