View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2728_low_22 (Length: 263)
Name: NF2728_low_22
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2728_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 1619185 - 1619059
Alignment:
| Q |
127 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619185 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc |
1619086 |
T |
|
| Q |
227 |
aattccattcttatacagatgatgatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1619085 |
aattccattcttatacagatgatgatg |
1619059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 243
Target Start/End: Complemental strand, 40387182 - 40387079
Alignment:
| Q |
146 |
tgacttctcatctta-gatctacccactatgctatttttgcttttctt---ttcttaattt-cattggaatgatcatgctctatgca--attccattctt |
238 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||| ||||||| || |||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
40387182 |
tgacgtctcatcttacgatctacccaccatgctatttctgctttttttctcttcttaattttcattg-aatgatcatgctctatgcaatattccattctt |
40387084 |
T |
|
| Q |
239 |
ataca |
243 |
Q |
| |
|
||||| |
|
|
| T |
40387083 |
ataca |
40387079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University