View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2728_low_22 (Length: 263)

Name: NF2728_low_22
Description: NF2728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2728_low_22
NF2728_low_22
[»] chr7 (1 HSPs)
chr7 (127-253)||(1619059-1619185)
[»] chr4 (1 HSPs)
chr4 (146-243)||(40387079-40387182)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 1619185 - 1619059
Alignment:
127 gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1619185 gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc 1619086  T
227 aattccattcttatacagatgatgatg 253  Q
    |||||||||||||||||||||||||||    
1619085 aattccattcttatacagatgatgatg 1619059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 243
Target Start/End: Complemental strand, 40387182 - 40387079
Alignment:
146 tgacttctcatctta-gatctacccactatgctatttttgcttttctt---ttcttaattt-cattggaatgatcatgctctatgca--attccattctt 238  Q
    |||| |||||||||| ||||||||||| ||||||||| ||||||| ||   |||||||||| ||||| |||||||||||||||||||  |||||||||||    
40387182 tgacgtctcatcttacgatctacccaccatgctatttctgctttttttctcttcttaattttcattg-aatgatcatgctctatgcaatattccattctt 40387084  T
239 ataca 243  Q
    |||||    
40387083 ataca 40387079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University