View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_high_101 (Length: 222)
Name: NF2729_high_101
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_high_101 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 24044394 - 24044605
Alignment:
| Q |
11 |
cagagatctaatatgtcctgttatgcaagattttcttttttaacaatgttatatattcttgatgacagattatctggttagcggcaacttaatactttaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24044394 |
cagagatctaatatgtcctgttatgcaagattttcttttttaacaatgttatatattcttgatgacagattatctggttagcggcaacttaatactttaa |
24044493 |
T |
|
| Q |
111 |
actagtcgctgctcttatttcgtattacagaccgagaactttttcatttaaccctgggaaggatgaggggggagtaaagcatggttctcaataatatttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24044494 |
actagtcgctgctcttatttcgtattacagactgagaactttttcatttaaccctgggaaggatgaggggggagtaaagcatggttctcaataatatttg |
24044593 |
T |
|
| Q |
211 |
acaggtttaatt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24044594 |
acaggtttaatt |
24044605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University