View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_high_15 (Length: 559)
Name: NF2729_high_15
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 343 - 544
Target Start/End: Complemental strand, 5697715 - 5697514
Alignment:
| Q |
343 |
acacgttgcaacaatgactaaatctatgaagaacaaaatgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaatta |
442 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697715 |
acacattgcaacaatgactaaatctatgaagaacaaaatgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaatta |
5697616 |
T |
|
| Q |
443 |
tcccttagaggcaatgtttcgtggtgagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaaataggggaa |
542 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5697615 |
tcccttagaggcaatgtttcgtggggagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaattaggggaa |
5697516 |
T |
|
| Q |
543 |
at |
544 |
Q |
| |
|
|| |
|
|
| T |
5697515 |
at |
5697514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University