View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_high_63 (Length: 306)
Name: NF2729_high_63
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 35178724 - 35178805
Alignment:
| Q |
18 |
aattctccacttgacaacaaggtggaatgtttgagcttccagcttttttggaacttctcttgctatagagatctgtcactac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178724 |
aattctccacttgacaacaaggtggaatgtttgagcttccagcttttttggaacttctcttgctatagagatctgtcactac |
35178805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 212 - 295
Target Start/End: Original strand, 35178918 - 35179001
Alignment:
| Q |
212 |
gtctccatagtttcaaggaaaaaggtcagagagatctagaaacaaaacaaggttattaatgtggagaaaactcaaactattcat |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178918 |
gtctccatagtttcaaggaaaaaggccagagagatctagaaacaaaacaaggttattaatgtggagaaaactcaaactattcat |
35179001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University