View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_high_72 (Length: 283)
Name: NF2729_high_72
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 13394323 - 13394577
Alignment:
| Q |
7 |
tccaagaatattacaaaattgcatcctacatttacaaaattgcatcacccctgtaaaannnnnnnnnnnnnnnngagaaacaagaaacaaatgcaaaaat |
106 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13394323 |
tccaaaaatattacaaaattgcatcctatatttacaaaattgcatcacccctgtaaaattttgttttttgttttgagaaacaagaaacaaatgcaaaaat |
13394422 |
T |
 |
| Q |
107 |
tacaatacttttaatttacaattacttctctatcacccaatcatttttatattaccattttatccatgaatgattagtttaagataactttgttttgtgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13394423 |
tacaatacttttaatttacaattacttctctatcacccaatcatttttatattaccattttatccatgaatgattagtttaagataactttgttttgtgt |
13394522 |
T |
 |
| Q |
207 |
tggtcgtgttcataaaaaatactttttgtgttctatgattaagttttagtctcta |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13394523 |
tggtcgtgttcataaaaaatactttttgtgttctatgattaagttttagtctcta |
13394577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University