View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_high_80 (Length: 254)
Name: NF2729_high_80
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_high_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 13212757 - 13212520
Alignment:
| Q |
1 |
cggtcgttgcgcgaaggaggcagggtggtatctgcatccttagcggaagtgggaccgtcacaaacgtgtctctccgtcaaccgggatcgcctggtgcggt |
100 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
13212757 |
cggtctttgcgcgaaggaggcagcgtggtgtctgcatccttagcggaagtgggaccgtcacaaacgtgactctccgtcaaccagcatcgcctggtgcggt |
13212658 |
T |
|
| Q |
101 |
agtcacacttcatggaagatttgagatattatcattatctggctctttcctgccgccgcctgctccaccagcggcgtcaggattagccatatatctagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212657 |
agtcacacttcatggaagatttgagatattatcattatctggctctttcctgccgccgcctgctccaccagcggcgtcaggattagccatatatctagct |
13212558 |
T |
|
| Q |
201 |
ggtggacaaggacaggtcgtcggtggtagcgtggtggg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212557 |
ggtggacaaggacaggtcgtcggtggtagcgtggtggg |
13212520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University