View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_104 (Length: 233)
Name: NF2729_low_104
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 52002865 - 52003007
Alignment:
| Q |
1 |
tgtctgttgcaatgtttatttcttaaactaattaatgactacacaaatttatcaaataattaaggatgtttctgctgtcacagaaaataatgcaaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
52002865 |
tgtctgttgcaatgtttatttcttaaactaattaatgactacacaaatttatcaaataattaagaatgttt---ctatcacagaaaataatgcaaagaaa |
52002961 |
T |
 |
| Q |
101 |
tatttgaaaaggtcttctaataaataattgagtcttatatttagag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52002962 |
tatttgaaaaggtcttctaataaataattgagtcttatatttagag |
52003007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University